Novedades Cientificas y Médicas
16.8K views | +1 today
Follow
Novedades Cientificas y Médicas
temas relacionados con los avances cientificos que mejoran la calidad de vida en el mundo y en medicina, alargan la forma y el tiempo que vivimos...
Curated by Refernan Ref
Your new post is loading...
Your new post is loading...
Scooped by Refernan Ref
Scoop.it!

Eliminar basura de la Mitocondrias rejuvenece

Eliminar basura de la Mitocondrias rejuvenece | Novedades Cientificas y Médicas | Scoop.it
Refernan Refs insight:

ELIMINAR LA SENESCENCIA CELULAR = REJUVENECE
---------------------------------------------------------------------
Las células pueden eliminar normalmente mitocondrias defectuoso por un proceso llamado mitofagia. Los científicos fueron capaces de "engañar" a las células en la inducción de este proceso en gran escala, hasta que todas las mitocondrias dentro de las células se separaron físicamente. Para su sorpresa, observaron que las células del envejecimiento, después de perder sus mitocondrias, tomaron características similares a las células más jóvenes -es decir, se rejuvenecieron-. Los niveles de las moléculas inflamatorias, radicales libres de oxígeno y la expresión de los genes, que están entre los fabricantes de envejecimiento celular, cayeron al nivel que se espera que en las células más jóvenes.
---------------------------
"Es un descubrimiento emocionante y sorprendente", nos dice el equipo internacional de científicos dirigido por João Passos de la Universidad de Newcastle, el que demostrado, por primera vez que las mitocondrias son los principales factores desencadenantes del envejecimiento, y eliminando así la inducción a la senescencia evitó la senescencia en el hígado del ratón de pruebas. Passos nos cuenta que "Ya teníamos algunas pistas que la mitocondria juega un papel en el envejecimiento de las células, pero los científicos de todo el mundo han luchado para entender exactamente cómo y en qué medida éstos estaban involucrados". El equipo, con la participación de otras universidades del Reino Unido y EE.UU., también descifró el nuevo mecanismo por el cual las mitocondrias contribuyen al envejecimiento: la biogénesis mitocondrial, el complejo proceso por el cual las mitocondrias se replican a sí mismos, es un importante motor de envejecimiento celular.
---------------------
Este trabajo fue financiado por el Reino Unido de Biotecnología y Ciencias Biológicas de Investigación. El trabajo se ha descrito el 4 de febrero en un documento de acceso abierto en el EMBO Journa l, donde el equipo llevó a cabo una serie de experimentos genéticos que involucran células humanas cultivadas en el laboratorio y tuvo éxito en la eliminación de la mayoría, si no todas, las mitocondrias de las células del envejecimiento. Esto puede llevar a un tratamiento concreto de rejuvenecimiento a nivel 
celular.

--------------------

No comment yet.
Scooped by Refernan Ref
Scoop.it!

Diuréticos eficaz y barato para la hipertensión

Diuréticos eficaz y barato para la hipertensión | Novedades Cientificas y Médicas | Scoop.it
Los diuréticos fueron una de las primeras armas terapéuticas empleadas contra la hipertensión. Y a juzgar por los resultados presentados en el Congreso Europeo de Cardiología, que
Refernan Refs insight:

NOVEDADES CON LOS DIURETICOS CONTRA LA HIPERTENSIÓN
----------------------------------------------------------------
La combinación de dos diuréticos muy comunes a bajas dosis proporciona un gran efecto antihipertensivo y neutraliza los efectos secundarios que, tradicionalmente se asocian a estos fármacos, por lo que deberían considerarse como primera opción terapéutica en muchos pacientes. Varios estudios habían relacionado usar diuréticos tiazídicos (como hidroclorotiazida) con mayor riesgo de diabetes, pues reducia los niveles de potasio, lo que redujo su empleo.
-----
Un nuevo trabajo demuestra que usar la mitad de la dosis habitual de hidroclorotiazida (que ronda los 25 mg) combinada con otro diurético (amiloride de 10 mg-) que es otro diurético pero de una familia distinta a las tiazinas, mejora la acción anti-hipertensiva de los fármacos en solitario y elimina los riesgos metabólicos asociados a la terapia. Son fármacos que llevan más de 50 años de uso y son muy baratos, es una buena noticia para pacientes y sistemas sanitarios.
-----
En individuos más jóvenes, lo más común, explica el cardiólogo, era iniciar la terapia con medicamentos como los inhibidores de la enzima de conversión de la angiotensina (conocidos por sus siglas IECA) o los antagonistas de los receptores de la angiotensina II (ARAII). Pero estos nuevos datos obligan a reposicionar los diuréticos en primera línea en todos los casos. Las pruebas se hicieron en Londres con 399 pacientes obesos y con hipertensión (con una media de edad de entre 61 y 63 años): un grupo con 10 mg de amiloride, otro con 25 mg de hidroclorotiazida y otro combinando los dos fármacos a mitad de dosis. Todo x 3 meses.
---------
Otro estudio para la hipertensión resistente (también llamada refractaria) que es cuando los niveles no bajan de 140/90 mmHG pese indicar 3 fármacos anti-hipertensivos, uno de ellos un diurético. Si se añade el diurético ESPIRONOLACTONA se consigue controlar la hipertensión en el 70% de los casos sin efectos secundarios relevantes. Se establece, por primera vez, una jerarquía clara para el tratamiento de la hipertensión resistente y debería influir las futuras guías de tratamiento. La espironolactona también es un fármaco que se conoce hace décadas y que cuesta menos de un euro al mes.
---------

No comment yet.
Scooped by Refernan Ref
Scoop.it!

Mezcla de genes entre animales

Mezcla de genes entre animales | Novedades Cientificas y Médicas | Scoop.it
Refernan Refs insight:

MEZCLAR GENES HUMANOS CON ANIMALES ¿SABE QUÉ ES?
----------------------------------------------------------------
Las mezclas humano-animal se crean mediante la inyección de células madre humanas en embriones animales de pocos días, para después gestarlos en animales hembra. Al Inyectar células de una especie al embrión de otra especie se crean mezclas llamadas quimeras. El tratar de incubar órganos dentro de animales de granja tiene una oposición ética-religiosa porque supone la introducción de células humanas en embriones animales de maneras que podrían difuminar la línea entre especies. Otros tipos de quimera humano-animal ya están siendo empleados ampliamente en las investigaciones científicas, incluidos ratones humanizados, dotados de un sistema inmunológico humano. Tales animales se crean al añadir trozos de hígado y tálamo de un feto humano (extraídos después de un aborto) a un ratón después de nacer.
--------------
El pasado mes de septiembre, en una revocación de una política anterior, los Institutos Nacionales de Salud (NIH, por sus siglas en inglés) anunciaron que no apoyarían estudios que incluyan tales "quimeras humanas-animales" hasta que hubiera examinado las implicaciones científicas y sociales en mayor profundidad. Basándose en entrevistas con tres equipos, dos en California (EEUU) y uno en Minnesota (EEUU), el MIT Technology Review calcula que se han establecido unos 20 embarazos de cerdo-humano u oveja-humano durante los últimos 20 meses en Estados Unidos, aunque hasta ahora no se ha publicado ningún trabajo científico detallando los trabajos, y ninguno de los animales llegó a término.
------------
Un investigador, Juan Carlos Izpisua Belmonte del Instituto Salk, mostró unos datos sin publicar de más de una docena de embriones de cerdo que contenían células humanas. Otro, de la Universidad de Minnesota (EEUU), proporcionó fotos de un feto de cerdo de 62 días en la que la adición de células humanas parecía haber revertido un defecto congénito ocular. Al modificar los genes, los científicos pueden cambiar el ADN de embriones de cerdo u oveja con facilidad para que sean genéticamente incapaces de formar un tejido específico y luego, al añadir células madre humanas, esperan que estas asuman el trabajo de formar el órgano deseado, que entonces podría ser cosechado del animal para su uso en una operación de trasplante. Los humanos y los cerdos compartieron ancestro por última vez hace casi 90 millones de años. Un cerdo nace tras 114 días de gestación y el embrión de cerdo sólo mide unos 1,3 centímetros de largo, pero ya se ha desarrollado lo suficiente para ver si las células humanas están contribuyendo a sus órganos rudimentarios.
-----------
En Estados Unidos, ninguna ley federal restringe aún la creación de quimeras. La Universidad de Stanford pudo traer a EE.UU. al cientifico Nakauchi (japonez) con la ayuda de una beca de 6 millones de dólares del Instituto de Medicina Regenerativa de California, una agencia estatal establecida hace una década para eludir las interferencias políticas de Washington, D.C. (EEUU). Mientras que la prohibición de financiación del NIH no afecta a Nakauchi, ha presionado a los investigadores para que expliquen el propósito de su trabajo. En su laboratorio de Stanford abrió la puerta de una pequeña sala con incubadoras donde almacena los embriones, los cuales son casi invisibles para el ojo humano, la sala tiene unos microscopios especiales con microagujas para poder inyectar las células humanas.
--------------
El tipo de células humanas que añade son células madre pluripotentes inducidas (iPS) hechas de piel o sangre, reprogramadas químicamente, usando la fórmula ganadora del Premio Nobel y por comodidad, la mayoría de esas células iPS que introduce a los embriones animales son hechas de su propia sangre, puesto que reclutar voluntarios implica demasiado papeleo. Al desarrollarse sus células iPS dentro del animal, el tejido resultante será igual al suyo y será pieza de sustitución compatible. Esto puede solucionar la lista de espera para transplantes y en menos de un año podrían tener sus propios órganos de diseño. "Realmente no percibo un gran riesgo para la sociedad", afirma.
------------

No comment yet.
Scooped by Refernan Ref
Scoop.it!

El hipocampo sigue creando celulas nerviosas

El hipocampo sigue creando celulas nerviosas | Novedades Cientificas y Médicas | Scoop.it
¿Podemos, Adultos como, neuronas Nuevas CRECER? El neurocientífico Sandrine Thuret dados Que Podemos, y ella OFRECE Investigación y Consejos Prácticos Sobre CÓMO Podemos Ayudar a Nuestros cerebros mejor Realizar ánimo neurogénesis-Mejora, El Aumento de la Formación de la memoria y la prevention de la disminución Asociada Con El Envejecimiento en el Camino .
Refernan Refs insight:

Y también de la ONU EJEMPLO de la desactualización Que padecen los medicos ante Los Nuevos Avances. Se llama neurogénesis y es relatively nuevo this Conocimiento. ¿Podemos, Adultos como, neuronas Nuevas CRECER? El neurocientífico Sandrine Thuret dados Que Podemos, y ella OFRECE Investigación y Consejos Prácticos Sobre de Como Podemos Ayudar una cerebros Nuestros p Realizar ara neurogénesis mejor una, es esto, Aumentar la Formación de Memoria y la prevention de la disminución Asociada Con El Envejecimiento en el Camino .
----------------
La neurogénesis Puede Ser manipulada vía Actividad Física (sexo, gimnasia) o vía dieta (ayuno intermitente, el resveratrol, etc.) sana: sin Grasa, si omega 3 , no hay Líquidas Comidas, sin Seguido esquina ... ada su visión ...

No comment yet.
Scooped by Refernan Ref
Scoop.it!

Test Sanguineo predice Longevidad y salud

Test Sanguineo predice Longevidad y salud | Novedades Cientificas y Médicas | Scoop.it
Multiple news sources including Reuters and The New York Times have reported on a blood test that presumably can determine our biological age and health vi
Refernan Refs insight:

ANALISIS DE SANGRE PREDICE LONGEVIDAD Y SALUD - VIA TELOMEROS
-------------------------------------------------------------------------
Una empresa de biotecnología basada en Español, Life Length, afirma haber creado con precisión un análisis de sangre que determina tanto la longitud media de los telómeros y el porcentaje de telómeros cortos en las células. Y ahora las palabras dichas para conformar a los burocratas que controlan la salud, en los diferentes paises del mundo: "Esto no significa que vamos a decir a nadie cuánto tiempo van a vivir", dijo María Blasco, co-fundadora de Life Length y biólogo molecular en el Centro de Investigación español Nacional del Cáncer en Madrid. Aunque si alguién de 50 años de edad, tiene la longitud de los telómeros propia de un hombre de 70 años de edad, dijo: "Esto no significa que todo tu cuerpo es como el cuerpo de una persona de 70 años de edad.". Aún así, dijo, "Creemos que puede ser útil para las personas que están especialmente interesados en saber lo saludable que son."
-------------
La prueba de Life Length, que estará disponible en Europa en breve, llevará una etiqueta de precio fuerte de más de $ 700. Como era de esperar, la comercialización de este tipo de pruebas viene con su cuota de controversia dado el limitado de datos que está disponible en la predicción de la mortalidad o la morbilidad de una persona sobre la base de la longitud del telómero. Algunos expertos temen que las compañías de seguros de vida utilizarán la información para alterar potencialmente las primas. Life Length cree que la prueba puede servir para promover la investigación futura en terapias potenciales como la prueba de colesterol hizo en el pasado.
------------
Exámenes de sangre que buscan decirle a la gente su edad biológica -que proponen una pista sobre su longevidad o lo saludable que permanecerán- ahora ya están en venta. Las pruebas no pueden especificar cuántos meses o años una persona puede esperar vivir. Las pruebas miden los telómeros, que son estructuras en las puntas de los cromosomas que se acortan con la edad. Telómeros más cortos en sus glóbulos blancos son más propensos a desarrollar enfermedades como el cáncer, enfermedades del corazón y la enfermedad de Alzheimer, o incluso a morir antes. 
----------
Los estudios en ratones han sugerido que la extensión de los telómeros se alarga la vida. Aprovechando esto, los laboratorios están comenzando a ofrecer pruebas de longitud de los telómeros. Life Length hace la prueba por 500 euros (U$ 712), que le dice su edad biológica, que pueden no corresponder a su edad cronológica. Otra empresa, Telome Salud de Menlo Park, California, planea ofrecer una prueba a finales de este año por de U$ 200. Fue co-fundada por Elizabeth H. Blackburn, de la Universidad de California en San Francisco, que compartió un Premio Nobel en 2009 por sus descubrimientos relacionados con telómeros. Calvin B. Harley, el director científico de Telome Salud, dijo que la prueba sería similar al chequeo de un auto.
----------

No comment yet.
Scooped by Refernan Ref
Scoop.it!

FDA aprueba salmón

FDA aprueba salmón | Novedades Cientificas y Médicas | Scoop.it
Get the latest in biotechnology through daily news coverage as well as analysis, features, tutorials, webinars, podcasts, and blogs. Learn about the entire bioproduct life cycle from early-stage R&D, to applied research including omics, biomarkers, as well as diagnostics, to bioprocessing and commercialization.
Refernan Refs insight:

LA FDA APROBÓ EL SALMÓN TRANSGÉNICO 
-----------------------------------------------------------------
La FDA aprobó AquAdvantage ® Salmón, un salmón atlántico que ha sido genéticamente modificados (GM) para alcanzar el tamaño del mercado en menos tiempo que el salmón del Atlántico cultivado convencionalmente. Es el primer animal con gen alterado considerado seguro y apto para la cena. El salmón trae alimentos sanos y nutritivos a los consumidores de una manera ambientalmente responsable, sin dañar el océano y otros hábitats marinos", dijo Ronald Stotish, Ph.D., CEO de AquaBounty la empresa que desarrolló el GE salmón Atlántico. 
------------------
El uso de los sistemas de acuicultura en tierra, esta rica fuente de proteínas y otros nutrientes puede ser cultivado cerca de los principales mercados de consumo de una manera más sostenible. Estados Unidos importa más del 90% del marisco y del 95% del salmón del Atlántico que consume, explicó el Dr. Stotish. AquAdvantage Salmón ofrece oportunidad para una industria acuícola en el país económicamente viable, con un producto fresco y delicioso", añaden.
---------------------
El AquAdvantage Salmon es un pez hembra con tres juegos de cromosomas en lugar de dos, que contiene una construcción de ADN recombinante que está compuesto del gen de la hormona del crecimiento de salmón Chinook bajo el control de un promotor de otro tipo de pescado, un abadejo del océano. Esto según los informes permite el salmón crezca al tamaño del mercado doble de rápido que GE no de criadero de salmón del Atlántico, a pesar de que se eleva en aproximadamente un 10% menos alimentos. Son reproductivamente estériles.
-------------------

No comment yet.
Scooped by Refernan Ref
Scoop.it!

EDUDOC 2015: LO QUE VIENE

SOBRE LA SALUD DIGESTIVA Y OTRAS COSAS

Refernan Refs insight:

añada su visión ...

No comment yet.
Scooped by Refernan Ref
Scoop.it!

¿ Se puede comer carne o no ?

¿ Se puede comer carne o no ? | Novedades Cientificas y Médicas | Scoop.it

Click here for editar el contenido

Refernan Refs insight:

Y...¿ SE PUEDE COMER CARNE O NO ?
--------------------------------------------------------
Ustes es el que decide. La carne procesada mediante salazón, curado, fermentación, ahumado u otros procesos para mejorar su sabor o conservación: esto va desde SALCHICHAS, JAMONES, CARNE EN CONSERVA O LATA, CARNE SECA, PREPARADOS Y SALSAS DE CARNES, SALAME, SALAMINES, está en el grupo 1 de cancerígenos para los seres humanos. Esto significa que hay "suficiente evidencia" o pruebas convincentes de que causa cáncer colorrectal, páncreas y próstata. El riesgo deriva de algunos ingredientes como la sal o las nitrosaminas, que se añaden para impedir la contaminación bacteriana de la carne. En esa misma categoría de máximo riesgo ya figuran, por ejemplo, el tabaco, el amianto o la contaminación ambiental.
---------------
El riesgo aumenta con la cantidad de carne consumida y se calcula que cada 50 gramos de carne al día aumentan un 18% el riesgo de cáncer colorrectal. Con la evidencia disponible no se puede hablar de una cantidad mínima segura. En este caso se evaluaron 700 trabajos científicos por un grupo de 22 expertos de 10 países diferentes, y este elevo al grupo 1 de productos "cancerígeno para los humanos" a las carnes carnes procesadas: que haya sufrido una transformación industrial (tocino, jamones, lasañas preparadas, carnes envasadas, salchichas, etc). El consumo de carne roja está muy por encima de lo que recomiendan los organismos internacionales y ya con 50 gramos, aparece el riesgo. 
--------------
La OMS define como carne roja a todos los tipos de carne muscular de mamíferos, tales como la carne de res, ternera, cerdo, cordero, caballo o cabra; mientras, considera que es carne procesada la carne que se ha transformado a través de la salazón, el curado, la fermentación, el ahumado u otros procesos para mejorar su sabor o su conservación. La mayoría de las carnes procesadas contienen carne de cerdo o de res, pero también pueden contener otras carnes rojas, aves, menudencias o subproductos cárnicos tales como la sangre. Los oncologos por su parte, hablan de no ingerir carne mas de 2 veces a la semana y en cantidades modestas (50 gramos cada vez).
----------------
Resumiendo: las carnes procesadas fueron puestas en la primera de las cinco categorías de posibles agentes cancerígenos, junto al tabaco y el asbesto. Y las carnes rojas fueron colocadas en la segunda categoría

No comment yet.
Scooped by Refernan Ref
Scoop.it!

Genética y Salud - desásnese!

pongase al día con lo posible en genética...
Refernan Refs insight:

La genética y su salud hoy en el 2015...aprenda sobre ello

No comment yet.
Scooped by Refernan Ref
Scoop.it!

Biología del envejecimiento

Biología del envejecimiento | Novedades Cientificas y Médicas | Scoop.it
Refernan Refs insight:

LA BIOLOGÍA DEL ENVEJECIMIENTO - ¿QUÉ SABE USTED SOBRE ESTE TEMA?
--------------------------------
Entender el envejecimiento ayuda a envejecer. En los estudios realizados en ratones en su hábitat silvestre en Australia y África, se observó que el 90% de los animales mueren antes del año de vida y el 70% de ellos, mueren durante los primeros seis meses de vida. Esto contrasta con los 2 años que viven esos mismos ratones en un laboratorio y enseña que el fenotipo del envejecimiento aparece en medios protegidos. Por otro lado, el envejecimiento es el principal factor de riesgo para la gran mayoría de las enfermedades que son mortales en la población y predice la mortalidad en los hospitales: por ejemplo, la probabilidad de fallecer en una hospitalización de un paciente mayor de 70 años es mayor al 40%, pero ese riesgo sube al 70%, cuando se tienen 95 años. 
----------------
Es importante no confundir longevidad con envejecimiento. Se habla de especies o individuos longevos (aquellos que viven un gran número de años) pero aún no hay un consenso sobre la definición de envejecimiento, lo que en general se lo entiende como el proceso biológico universal que afecta a todo el cuerpo, que implica una pérdida progresiva de funciónes, que aumentan la probabilidad de morir, con el paso del tiempo. Hay distintas teorías que intentan explicar el porque envejecemos. Veamos algunas. LA TEORIAS ESTOCASTICAS, que son las basadas en el azar plantean que el envejecimiento ocurre de un modo aleatorio y el daño se va acumulando con el tiempo, debido a las agresiones del medio ambiente, hasta alcanzar un nivel incompatible con la vida. Ella no explica nada sobre lo que ocurre ni como. Esta era la teoría dominante en el pasado, ante la falta total de información sobre el funcionamiento del cuerpo humano, a nivel celular.
---------------
Otra teoría, un poco más racional, sobre el envejecimiento es la TEORÍA DE LAS MUTACIONES ACUMULATIVAS: la que plantea que el envejecimiento, luego de la reproducción, no está sometido a la presión de la selección natural y hay una serie de genes que producen en la vejez, un daño tal que lleva a la muerte. Aqui la naturaleza no solucionó el tema de limpiar los genes perjudiciales, luego de la reproducción. Esta teoría implica que los organismos son como máquinas cuyo único fin es transmitir genes y fenotipos a las otras generaciones para sobrevivir. Así que todos los mecanismos que permiten mantener al organismo en buenas condiciones, incluyendo la reparación celular y limpieza de daños, funcionan sólo durante la etapa fértil de la vida, luego de la cual, deja de tener sentido la lucha contra la entropía para mantener el cuerpo vivo. 
---------------
Todo indica que pueden haber genes muy favorables para la etapa inicial, pero que a largo plazo se asocian a un fenotipo negativo (cambia el entorno y los hábitos de vida) y ellos ahora causan daño. Un buen ejemplo es el de los genes relacionados con el almacenamiento de energía a través de la acumulación de grasa en el organismo, los que permiten defenderse del frío y del hambre cuando se es joven, pero luego, se asocian a un fenotipo negativo. Así, los organismos jovenes que repiten ese cambio de entorno y hábitos de vida de la vejez, sufren las mismas consecuencias negativas que los organismo viejos. Aún no sabemos bien cuales son todos los genes que cambian en este proceso del envejecimiento desfavorable, por lo complejo del tema y por la indiferencia que provoca aún estos temas. Es probable que estén involucrados los genes de la familia APO, que regulan las lipo-proteínas, los genes relacionados con interleuquinas involucradas en la inflamación y los que codifican para ciertas moléculas reguladoras del metabolismo de la glucosa. 
-----------------
Con el envejecimiento (65 años por convención en 1984) se inicia un proceso de deterioro paulatino de órganos y sus funciones asociadas. Muchas enfermedades, como ciertos tipos de demencia, enfermedades articulares, cardíacas y algunos tipos de cáncer han sido asociados al proceso de envejecimiento. A nivel celular, se sabe que las células normales están programadas para un número determinado de divisiones. Cada cromosoma celular tiene en sus extremos unas secuencias repetitivas y no codificantes llamados telómeros. Al replicarse el ADN de las células, los telómeros se van acortando con las divisiones. Aquí la enzima telomerasa, atenua esto en las células embrionarias, pero se inactiva en las células somáticas, lo que lleva al acortamiento progresivo de telómeros y cuando estos llegan a cierto nivel mínimo, se desencadena un mecanismos que conduce a la muerte celular. Por ello el largo de los telómeros representa una forma de calcular el tiempo de vida de las células.
----------------
Se pueden apreciar a simple vista algunas características del envejecimiento humano que se repiten en todas las personas, a distintas edades, sin importar el medio ambiente y los hábitos que se tengan:
1) Pérdida progresiva de los sentidos: vista, oído, gusto y olfato.
2) Pérdida progresiva de fuerza, elasticidad, agilidad y reflejo muscular. Pérdida del colágeno. 
4) Alteración del sueño.
5) Degeneración ósea (acromegalias, osteoporosis, artritis reumatoideas).
6) En cerebro: demencia senil, pérdida de memoria y de razonar y Alzheimer.
8) Sube por acumulación la hipertensión arterial, colesterol y glucosa en sangre.
9) Se altera la Prostata y se degrada el sistema inmune.
10) Pérdida progresiva de la libido, menopausia en la mujer.
------------------------
Nuestro cuerpo es un sistema en EQUILIBRIO DINAMICO entre la degradación y la reparación constante. El envejecimiento ocurre cuando se produce una ruptura de ese equilibrio, es decir, cuando el daño supera la capacidad de reparación. Para que esta ruptura de ese equilibrio dinámico se produzca hacen falta que ciertos factores fallen. Estos factores incluyen genes, medio ambiente y hábitos de vida, los cuales afectan de manera positiva o negativa el proceso de equilibrio. La acumulación de daños moleculares del envejecimiento se debe a varios fenómenos:

1) LOS RADICALES LIBRES: que se crea a partir de un enlace débil donde un electrón queda sin pareja. Esto produce ROS (especies reactivas del oxigeno) dentro de las mitocondrias que son compuestos moleculares inestables, extremadamente reactivos, que alteran todos los componentes celulares (ácidos nucleicos, proteínas y lípidos). Se calcula que cada molécula de ADN contenida en cada una de nuestras células es objeto de 10.000 ataques diarios de los radicales libres. El ADN en el interior de las mitocondrias está más expuesto que el ADN del núcleo, por estar próximo a la fuente de los ROS y estar menos protegido, al carecer de histonas. Cuando la producción de energía ATP disminuye por debajo de un umbral, la célula desencadena su muerte celular por apoptosis, lo que disminuye las células productoras de energía y contribuye al envejecimiento.

2) LA GLICACIÓN: algunos azúcares esenciales como la glucosa, reaccionan con los aminoácidos de las proteínas de nuestro organismo (pero también con los ácidos nucleicos y los lípidos), en una reacción química lenta llamada glicación, la cual avanza y acumula en productos de glicación avanzada llamados PGA. La glicación (llamada también reacción de Maillard) se estudió en los alimentos. Al envejecer, se produce una acumulación de lesiones producidas por la oxidación de los radicales libres y van a "caramelizarse" por efecto de la glicación. Este proceso sinérgico se conoce como glicoxidación, y esta implicado en la diabetes, las cataratas, el alzheimer, la aterosclerosis, las nefropatías o las alteraciones vasculares periféricas, entre otras.

3) LA SENESCENCIA CELULAR: los telómeros se van acortando. Los fibroblastos humanos fetales pueden dividirse unas 60 veces, luego entran en G0 o quiescencia, del que no saldrán. Si tomamos el mismo tipo celular en alguién con 40 años, se dividirán unas 40 veces, mientras que si se toman de un individuo de 80 años, sólo se dividirán unas 30 veces: hay una relación entre la edad y la capacidad de dividirse de sus células. Este fenómeno de senescencia se identificó en los años 1960 y se llama "límite de Hayflick" en honor al descubridor. En los 80 se supo el tema de los telómeros asociado a esto: al alcanzar un mínimo, se activa una respuesta de daño del ADN, dependiente del gen supresor tumoral denominado p53, que desencadena la muerte celular por apoptosis. El mecanismo de p53 se activa cuando se produce cualquier tipo de lesión oxidativa del ADN, o por modificaciones de la cromatina que alteran su estructura (por ejemplo por efecto de un fármaco) o también cuando se producen modificaciones oncogénicas.

Para evitar la acumulación de daños en el ADN, la célula posee una batería de enzimas responsables del mantenimiento y la reparación así como una telomerasa encargada de restituir la longitud de los telómeros. Sin embargo, la telomerasa se reprime en tejidos somáticos, mientras que los mecanismos de reparación, como el resto de los componentes celulares, acumulan también daños que los inactivan de forma progresiva. Desde este punto de vista, la senescencia y la muerte celular constituye un mecanismo de defensa, evitando que células que acumulan daños en su ADN puedan proliferar, dado que las células dañadas pueden convertirse en tumores y aumentar el riesgo de cáncer.
--------------------------
ENVEJECIMIENTO Y REPRODUCCIÓN: hay una relación entre la función reproductora y el envejecimiento. En los animales se observa que en las especies con reproducción múltiple, una reproducción precoz está ligada, estadisticamente a una disminución de la esperanza de vida. En otras especies, la reproducción única está ligada a un envejecimiento acelerado y una muerte precoz. Esta relación se ha estudiado experimentalmente usando como modelo moscas de la especie Drosophila:11 cuando se seleccionan moscas durante muchas generaciones (en función de un timing impuesto de reproducción) se observa que las moscas a las que se les ha impuesto una reproducción tardía son más longevas que las moscas con reproducción precoz. Esta diferencia en la longevidad se observa después de 10 años de selección a partir de un ancestro común. Por otro lado, se ha demostrado experimentalmente que los tejidos reproductivos pueden emitir una señal capaz de influenciar la longevidad. Así, la irradiación de drosófilas con dosis radiactivas débiles, que destruyen sus ovocitos, aumenta la vida media de estos insectos. También se observa un efecto similar si de destruyen las células germinales en el gusano C. elegans o en ratones.
-------------------
Recientemente se ha entendido un mecanismo genético universal, conservado a través de la evolución, que controla la rapidez del proceso del envejecimiento en la mayoría de las especies. La función de estos genes sería adaptar la distribución de los recursos energéticos en relación con las limitaciones del entorno para permitir la reproducción: en buenas condiciones ambientales (alimento ampliamente disponible), estos genes controlarían el uso de la energía disponible hacia el crecimiento, la madurez sexual y la reproducción. Esta estrategia implicaría descuidar las actividades de mantenimiento y reparación, lo que llevaría a envejecimiento prematuro y fallecimiento precoz. Pero cuando hay RESTRICCIÓN CALORICA, cuando no hay suficiente alimento disponible, los recursos disponibles van a los mecanismos de supervivencia (mantenimiento y reparación), y se ralentiza así el proceso de envejecimiento, para permitir al organismo que espere las condiciones más favorables para la reproducción.

Las vías metabólicas implicadas en este proceso incluyen al factor de transcripción FOXO y las SIRTUINAS. La actividad de FOXO está regulada por la vía de señalización de la insulina, y su activación induce la transcripción de muchos genes implicados en la resistencia al estrés, la reparación del ADN, la apoptosis, el control del ciclo celular. Por su parte, las sirtuinas son deacetilasas o ADP ribosilasas que utilizan NAD como cofactor, y por tanto pueden funcionar como sensores del estado metabólico celular. Su activación (por restricción calórica) aumenta la longevidad de los organismos, de manera dependiente de FOXO. Algunas sustancias, como el resveratrol presente en las uvas y sus derivados (entre otros alimentos), son activadoras de las sirtuinas.
--------------------
LAS CONSECUENCIAS DE ENTENDER EL ENVEJECIMIENTO: Para resumir, el envejecimiento está asociado con dos procesos que se superponen y que finalmente llevan a la muerte del organismo: la degeneración progresiva de las células y la pérdida de la capacidad regenerativa. Tanto la degeneración como la regeneración de las células son procesos que ocurren en cada una de las etapas de la vida y permanecen en un perfecto equilibrio en condiciones normales, no patológicas. Los puntos de control y los mecanismos de reparación celulares permiten que las células dañadas sean reemplazadas, preservándose así la integridad funcional de tejidos y órganos. Sin embargo, en el envejecimiento esta balanza se inclina hacia la degeneración y ella está principalmente relacionada a la oxidacion y la glicación de proteínas: ambos procesos muy relacionados con factores ambientales. Luego la capacidad regenerativa estaría determinada genéticamente por el acortamiento de los telómeros y los procesos de muerte celular. Esta forma de entender el proceso, resalta la importancia y participación de factores exógenos como endógenos en el envejecimiento. Hay otros factores ambientales y de hábitos que ayudan a degradar o defender: los fumadores, por la inhalación permanente de radicales libres de oxígeno, pueden ayudar en la degradación. El tomar mucho sol, puede envejecer prematuramente la piel. La restricción calórica en cualquier momento de la vida, mejora la mayor parte de los parámetros biológicos e incrementa la longevidad, una dieta equilibrada en fibras y vegetales (antioxidantes naturales) será también positiva.
--------------------
LAS INVESTIGACIONES SOBRE EL ENVEJECIMIENTO: Se puede resumir que el envejecimiento comienza a los 30 años, aunque se sabe que la memoria y los reflejos ya declinan a partir de los 24 años. Especialistas del Centro Nacional de Investigaciones Oncológicas (CNIO), han desarrollado un tratamiento que actúa sobre los genes que, aplicado en ratones adultos, una única vez, consigue de manera segura alargar la vida media de los individuos. Este tipo de investigaciones obligaba a modificar permanentemente los genes de los animales desde la fase embrionaria. Sin embargo, la terapia génica desarrollada por el CNIO para combatir el envejecimiento ha sido probada en ratones adultos de uno y dos años, e igual tuvo un efecto rejuvenecedor sobre ellos. El procedimiento consiste en modificar la carga genética de un virus cuyo ADN ha sido modificado, sus genes se sustituyen por uno de los genes más importantes para el envejecimiento de las especies tratadas: el que codifica la enzima telomerasa. El virus con el ADN tratado e inoculado en el animal actúa como un vehículo que deposita el gen de la telomerasa en las células. 
-------------
En diciembre de 2013 la revista Cell publicó una investigación según la cual se ha podido revertir uno de los mecanismos del envejecimiento, el relacionado con el desgaste y ruptura de la comunicación química molecular entre el núcleo celular y la mitocondria. El trabajo demuestra, solo en ratones por ahora, que suministrando un compuesto natural fabricado por el propio organismo humano, se logra revertir el envejecimiento al menos para tres indicadores básicos de una buena salud: resistencia a la insulina (una condición que eleva el riesgo de diabetes), la inflamación (relacionada con cáncer y enfermedades cardiovasculares) y, quizá lo más importante, el desgaste muscular. Otro estudio mas reciente apunta aque la Turritopsis nutricula, que es una medusa que no muere, se rejuvenece sola , debido a su capacidad natural de programar sus células para renovarse, aparte que soporta cualquier tipo de clima en el planeta pero no tiene sistema nervioso, la clave celular o la programación del rejuvenecimiento pareciera estar en esta medusa.
--------------

No comment yet.
Scooped by Refernan Ref
Scoop.it!

El Futuro ya esta aquí

El Futuro ya esta aquí | Novedades Cientificas y Médicas | Scoop.it
Refernan Refs insight:

EL FUTURO YA ESTA AQUÍ...PARECE
--------------------------------------
Podemos ver que el ser humano ha logrado ya conocimientos y tecnología que puede cambiar totalmente la sociedad en que vivimos, pero no hacemos uso de ella, porque no tenemos aún lideres que nos lleven por esos caminos, de manera más rápida que la evolución natural. Tomemos por ejemplo la producción de ENERGÍA ELÉCTRICA. Estamos aún explotando el petroleo y el carbón como fuentes principales, cuando ya sabemos como abastecer al mundo con energía solar o eólica. Incluso, en reciente presentación de la batería de Tesla, hecha por su CEO, el explica como todo el mundo podría tener energía eléctrica a través de ella, sin contaminación ni el calentamiento global que preocupa tanto a algunos y el transporte podría también pasar a ser eléctrico en un 100 % del planeta.
----------------
Si tomamos los adelantes ya existentes en materia de biología y medicina, parece claro que tenemos el conocimiento para estar en condiciones de elevar la esperanza de vida de las poblaciones a unos 120 años de vida saludable. Esto es lo que nos dice la GENÉTICA Y EPI-GENÉTICA en las pruebas de laboratorio. Incluso, los canceres y otras enfermedades deberían desaparecer a corto plazo con el beneficio del diagnostico precoz y el tratamiento local sin efectos secundarios, ambas cosas que la nanotecnología parece ya haber logrado en esas mismas pruebas de laboratorio. Entonces vemos que, el conocimiento está, pero la sociedad no lo puede aprovechar dado que precisa de lideres o guías que le indique cómo y cuando hacerlo. Es claro que todos estos logros vendrán dentro de unos 50 años, si dejamos que la evolución natural siga operando a su velocidad de tortuga.
----------------
En la ECONOMÍA vemos que ocurre otro tanto: ya sabemos como producir energía barata, alimentos baratos y sanos, construir casas durables y baratas, tener agua potable en abundancia, etc. Pero no estamos en condiciones de aplicar esos conocimientos aún para poder vivir en consecuencia. Nuestras sociedades se debaten en discusiones antiguas e inútiles que son la vieja política y la vieja economía. El sistema de estudiar y luego conseguir un trabajo e ir a una oficina hasta conseguir una jubilación, ya no parece tener mucho que ver con la sociedad que podemos tener hoy, ni con las actividades que son necesarias para avanzar más rápidamente, que la velocidad impuesta por la vieja evolución natural darwiniana. Bastaría que los lideres de los 10 países más ricos hiciera un plan a 5 años para crear el abastecimiento energético sostenible y no contaminante para el grupo basado en energía solar y eólica, por ejemplo. Igualmente podría hacerse en ese plazo con respecto al problema de comer proveer los bienes necesarios (casas, ropa, comida, etc.) que esa nueva sociedad de 10 naciones precise y que asimismo, determine nuevas formas de estudiar y pasar el tiempo en esas nuevas sociedades. Donde el tener buenas relaciones amistosas, emocionales, sexuales no sea un problema para nadie, a ninguna edad ni en ninguna situación.
----------------- 
Bueno, quizás puedan precisar en vez de 5, digamos unos 10 años, pero son todas cosas no sólo ya posibles, sino que son necesarias de hacer, para terminar con las burbujas decadentes de la contaminación, escasez, terrorismo e inseguridad con que nos amenazan constantemente algunos sectores del mundo. Usted...¿tiene alguna idea al respecto?...o ¿cree que es correcto continuar viviendo como lo estamos haciendo ahora?
----------------

No comment yet.
Scooped by Refernan Ref
Scoop.it!

La esperanza de vida y Usted

La esperanza de vida y Usted | Novedades Cientificas y Médicas | Scoop.it
Refernan Refs insight:

LA ESPERANZA DE VIDA Y SUS RAZONAMIENTOS
--------------------------------
Usted ¿qué explicación le encuentra a que halla países con mayor esperanza de vida que otros?. Pensar que tiene algo que ver el clima no tiene mucho sentido porque varia aún a igualdad del clima. ¿La altitud?. Para hacer más corto el razonamiento: la riqueza o pobreza del país es lo que influye sobre la esperanza de vida. Esta bien pensar que ellos tienen mejores vacunas, mejores hospitales, en fin. Pero aún así, dando estos hechos como causales, sigue sin explicarse del todo. 
--------
Quizás el panorama se le aclare si incluimos la contaminación ambiental por ejemplo. El motor diésel contamina el aire y aumenta las enfermedades cardíacas, pero en los países ricos han solucionado el problema aplicando nano-tecnología al combustible. Las fibras de amianto al respirarse ingresan a los pulmones y generan un cáncer llamado mesotelioma. Los programas de vacunación son mas efectivos y se respetan más en los países serios. Igual podemos decir con las rutas y autopistas que generan menores accidentes de tránsito. Otro tanto podemos decir de los muertos por la inseguridad en robos, asaltos y asesinatos: es claro que donde hay más impunidad o menos justicia, hay más delitos y esto, otra vez, coincide con tener gobiernos de bajo nivel.
--------
Quizás, el entender que ser manejados por políticos que ni saben, ni les interesa saber sobre estos temas, quizás es lo que verdaderamente influye en la esperanza de vida de un país o de una persona como usted. En Venezuela la esperanza de vida es de 75 años y en Argentina de 76, pero en Chile es de 80 y en Bolivia es de 67 años, y ahora con esos datos en su poder, yo le vuelvo a preguntar ¿a que cree que se debe que un japonez o un suizo viva el doble que un africano?
--------------

No comment yet.
Scooped by Refernan Ref
Scoop.it!

Como usar los datos en medicina

Como usar los datos en medicina | Novedades Cientificas y Médicas | Scoop.it
El Aprendizaje automático y la ciencia de Datos van a Hacer Más párr Mejorar la Salud de TODAS LAS CIENCIAS BIOLÓGICAS Combinadas. Este es el blog about Cómo Vamos a recopilar organismos europeos de normalización Datos de Salud, la mia es ... leer más
Refernan Refs insight:

LA IMPORTANCIA DE USAR DATOS EN MEDICINA ¿Cuál es la gran idea?

-----------------------------------------------------
Su genoma consta de aproximadamente 3.2 mil millones de pares de bases (el ADN) que codifican literalmente tu yo, es decir, toda tu persona. Su código de genes determina las enfermedades que podría tener, si es bueno en matemáticas o con la música, como será su memoria y cuan buena es, cómo te ves fisicamente, como te sientes, cuánto tiempo es probable que vivas y muchos más datos. Esto significa que si podemos descifrar este código genómico podemos predecir su futuro biológico y trabajar para anticipar y mejorar su salud.
---------------
Es un problema de datos - y si usted es un científico de datos o experto de aprendizaje de máquinas- esto será el problema más interesante e importante que podría tratar de solucionar. En términos más simples, secuenciar un genoma significa convertir el ADN en una serie de cuatro letras que se parece a esto:
ACAAGATGCCATTGTCCCCCGGCCTCCTGCTG
Y ese genoma es un archivo de texto de unos 300 gigabytes.
--------------
Al comparar su genoma secuenciado con millones de genomas de otras personas y el conjuntos de datos de los servicios de salud, podemos usar la máquina de aprendizaje y técnicas de minería de datos, para co-relacionar ciertos rasgos (color de los ojos, lo que su cara parece) o enfermedades (Alzheimer, Huntington, etc.) a ciertos factores en los datos y comenzar a desarrollar diagnósticos/terapias personalizadas. Manipular los datos biológicos es como un problema de traducción, como el Google Translate. La base de datos biológicos es HLI, y todo el mundo entra en ella. Los conjuntos de datos creados incluyen lo siguiente:

-Genómica: Los 3.2 mil millones de nucleótidos de madre igual de su padre.
-Microbioma: El genoma de los 100 billones + microorganismos de nuestro cuerpo. 
-La MRI/Imagenología: imágenes detalladas del cerebro, los órganos y el cuerpo.
-Metabolome: Los 2.300 moléculas en el torrente sanguíneo.
-Datos de Salud Fisiológica: Todos los datos de nosotros mismos: signos vitales, niveles de glucosa en sangre, los micro ARN en la circulación sanguínea, la frecuencia cardíaca, VO2 ...
Si traducimos todos estos datos obtendremos un resulado de tu salud. Similar a cómo Google Translate actúa.
----------------
El Traductor de Google (GT) usa un proceso llamado traducción automática estadística, lo que significa que GT genera traducciones basadas en patrones que se encuentran en grandes cantidades de texto escrito. En vez de enseñar a la computadora todas las reglas de todos los idiomas, este enfoque permite que ella descubra las normas por sí misma en base a los patrones estadísticos significativos en los datos. Una vez que halla estos patrones, puede usar este "modelo" para traducir el texto similar en el futuro. Asi traduce en 90 idiomas diferentes. El reto ahora es usar lo mismo con la Genética, los registros de salud, y nos encontramos a la persona perfecta para liderar este esfuerzo: Franz Och - el hombre responsable de la construcción de Google Translate. "La gran misión es aprender a interpretar el genoma humano y ser capaces de predecir cualquier cosa que nos pasa a partir del código fuente". 
----------------
HLI está buscando ahora mismo lo siguiente: fuertes ingenieros de software que pueden construir de alta calidad, software fiable y de alto rendimiento, Expertos de aprendizaje automático y Estadísticas expertos. Aqui puede aplicar: http://www.humanlongevity.com/careers/open-positions/

ñada su visión ...

No comment yet.
Scooped by Refernan Ref
Scoop.it!

Mitochondrias y envejecer

Mitochondrias y envejecer | Novedades Cientificas y Médicas | Scoop.it
Scientists have carried out an experiment which conclusively proves for the first time that mitochondria are major triggers of cell aging.
Refernan Refs insight:

LAS MITOCONDRIAS Y EL ENVEJECIMIENTO
--------------------------------------------------
Un equipo de científicos tiene por primera vez demostrado que las mitocondrias (las baterías de las células) se relacionan con el envejecimiento, que cuando el envejecimiento de las mitocondrias fue eliminado las células senescentes se volvieron más similares a las células jóvenes. Se probó que las mitocondrias son los principales causas del envejecimiento celular. Esto hace que se este más cerca de desarrollar terapias para contrarrestar la senescencia celular, apuntando a las mitocondrias.
-----------------
A medida que envejecemos las células acumulan daños y aumentan la inflamación, lo que contribuye al envejecimiento. El equipo llevó a cabo una serie de experimentos genéticos que involucran células humanas cultivadas en el laboratorio y tuvo éxito en la eliminación de la mayoría, si no todas, las mitocondrias de las células del envejecimiento. Las células pueden eliminar normalmente mitocondrias defectuosas por mitofagia. Lograron engañar a las células para inducir este proceso en gran escala. Para su sorpresa, observaron que las células senescentes, después de perder su mitocondrias, tomaron características similares a las células más jóvenes, es decir, se rejuvenecieron. 
----------------
Los niveles de moléculas inflamatorias, de radicales libres de oxígeno y de expresión de genes que se encuentran entre los marcadores del envejecimiento celular se redujo hasta el nivel que se esperaría en las células más jóvenes. El equipo ha descifrado un mecanismo por el que las mitocondrias contribuyen al envejecimiento, la biogénesis mitocondrial, el complejo proceso por el cual las mitocondrias se replican a sí mismas, y es importante motor de envejecimiento celular. "Esta es la primera vez que un estudio demuestra que las mitocondrias son necesarios para el envejecimiento celular. Ahora estamos un paso más a la elaboración de las terapias que se dirigen a las mitocondrias para contrarrestar el envejecimiento de las células"
----------------

No comment yet.
Scooped by Refernan Ref
Scoop.it!

La edición Genética CRISP/CAS9/CPF1

La edición Genética CRISP/CAS9/CPF1 | Novedades Cientificas y Médicas | Scoop.it
Refernan Refs insight:

LA EDICIÓN GENÉTICA EN SU APOGEO
-----------------------------------------------------
CRISPR/Cas9 es una tecnología casi mágica y con razón. La técnica permite a los científicos alteran el ADN de las células vivas y, es de esperar, lograr un objetivo de larga data de la ciencia para tratar la enfermedad a nivel genético. Pero debemos lograr acallar las voces moralistas que nos hablan de catastrofes y desvios médicos. Debido a su importancia, CRISPR también se ha sumido en la controversia, incluyendo acalorados debates sobre sus implicaciones éticas y una guerra legal sobre quién posee la tecnología.
-----------
Esa es una oferta muy grande. Se estima que unos 6.000 enfermedades son causadas por mutaciones genéticas, y sólo el 5% se pueden tratar. Tome la anemia de células falciformes, por ejemplo. A menudo mortal, que es causada por una sola mutación en uno de los tres mil millones de pares de bases de ADN del cuerpo humano. Es un pequeño error, bien entendido en el código genético, pero hasta ahora hemos sido incapaces de repararlo. El sistema Cas9/CRISPR, a menudo descrito como un par de tijeras de ADN, podría concentrarse en los pares de bases molestas causando anemia de células falciformes, y reemplazarlos.
---------
La Oficina de Patentes y Marcas se prepara para decidir si la Universidad de California en Berkeley Jennifer Doudna o Feng Zhang del Instituto Broad del MIT será el propietario de la patente para el uso de CRISPR editando genomas eucarióticos. La decisión afectará significativamente varias startups fuertemente financiados creado para desarrollar tratamientos de terapia génica utilizando CRISPR. Secuencias de CRISPR se producen naturalmente en sistemas inmunes primordiales y se encuentran en aproximadamente el 40 % de las bacterias y el 90 % de arqueas (microorganismos unicelulares), y Cas9 es sólo una de las muchas proteínas asociadas con secuencias de CRISPR.
---------
El sistema Cas9/CRISPR, entonces, es sólo uno de muchos posibles nuevas técnicas para editar el gen de células vivas. Y el debate de su patente podría compararse a la vez en el año 1885 cuando un competidor logró despojar a Thomas Edison de una patente sobre una bombilla con un filamento de papel, solo que entonces ya no importaba, porque Edison había inventado una mejor bombilla. Mientras se discute todo esto, en septiembre del 2015 Zhang y su equipo en el Instituto Broad publicaron un estudio que describe un sistema más sencillo y preciso para editar el genoma utilizando la enzima CPF1 lugar de Cas9, que corta el ADN diferente: Cas9 corta ambas cadenas de ADN en el mismo lugar, dejando a "extremos romos", en cambio CPF1 se compensan, permitiendo a los investigadores para integrar un fragmento de ADN con más precisión y facilidad y la reducción de las posibilidades de mutaciones no deseadas.
--------
Ya sea CRISPR o cualquier otra tecnología de edición del genoma es potente y hay que sopesar sus beneficios potenciales. Para los padres de los niños que nacen con debilitante trastornos genéticos o para las personas que desarrollan una enfermedad genética más tarde, la oportunidad de vivir una vida próspera y saludable es sin duda lo que justifica el riesgo potencial. Por supuesto, habrá muchos religiosos, políticos y técnicos obstáculos que superar antes, de lo contrario, como la gran mayoría de grandes inventos, deberá postponerse por unas 5 a 10 décadas. Ocurrió con la evolución de Darwin, el Big Bang, la energía de fusión atómica y tantas otras cosas que estan suspendidas en el tiempo debido a la mala administración de recursos y capacidad técnica.

No comment yet.
Scooped by Refernan Ref
Scoop.it!

DEL BIG BANG AL HOY QUE CONOCEMOS

Una visión del Mundo real Que intenta explicar los porqué Y Como Enfrentar los Problemas Que TENEMOS Como sociedad
Refernan Refs insight:

añada su visión ...

No comment yet.
Scooped by Refernan Ref
Scoop.it!

IMPORTANCIA DE VIVIR EN EL SIGLO XXI

La Importancia de manejarse con Información y Conocimientos Ciertos en la vida ...
Refernan Refs insight:

Vivir con la mente en el siglo XXI es importante para la sociedad y cada uno de nosotros.......

No comment yet.
Scooped by Refernan Ref
Scoop.it!

EDUDOC 20 2015 EL UNIVERSO, LA CIENCIA Y USTED

¿Qué relación hay entre usted, la ciencia y la forma en que vive su día a día?...la sociedad humana es sólo una suma de usteds...
No comment yet.
Scooped by Refernan Ref
Scoop.it!

Test de sangre anticipa el alzheimer

Test de sangre anticipa el alzheimer | Novedades Cientificas y Médicas | Scoop.it
Expertos británicos desarrollan una prueba de sangre que anticipa el alzheimer
Refernan Refs insight:

HALLAN BLOOD TEST QUE DETECTA ALZHEIMER: en 3 años estará disponible
-------------------------------------------------------------------------------------------------
Científicos británicos han desarrollado una prueba de sangre que puede predecir con bastante precisión el comienzo del alzheimer, lo que abre el camino para elaborar fármacos que ayuden a tratar el mal con anticipación. La prueba -que puede predecir con un 87% de exactitud si una persona desarrollará la enfermedad en el plazo de un año- ha estado a cargo de expertos de la Universidad inglesa de Oxford y el Kings College London, que han realizado numerosos análisis de investigación en los últimos diez años. Los científicos, que dieron a conocer hoy su estudio y lo publican en la revista "Alzheimer & Dementia", han identificado 10 proteínas en la sangre que muestran que el mal es inminente tras realizar las pruebas a más de mil personas.
-------------
Este importante avance permitirá ahora iniciar las pruebas clínicas, aunque aún pasarán unos años hasta que el examen de sangre pueda estar disponible para la población, según indicaron. Los investigadores observaron las diferencias en pruebas de sangre de tres grupos: 452 personas sanas, 220 con deterioro cognitivo y 476 con alzheimer, lo que les permitió concluir con un 87% de certeza que los pacientes con un ligero deterioro cognitivo podían desarrollar la enfermedad en el plazo de un año. El ministro británico de Sanidad, Jeremy Hunt, calificó hoy este estudio de un "gran paso adelante", mientras que muchas organizaciones benéficas que ayudan a pacientes con la enfermedad han destacado que esto puede revolucionar los tratamientos.
------------
"El alzheimer empieza a afectar al cerebro muchos años antes de que los pacientes reciban el diagnóstico de la enfermedad. Si podemos tratar el mal en esa fase, podríamos tener una estrategia de prevención", subrayó Lovestone. "En este momento, la gente viene y me dice que tiene pérdida de memoria y me preguntan si van a tener alzheimer. Yo les tengo que decir que vuelvan en un año. Es horrible". Actualmente no hay manera de diagnosticar el mal con anticipación y sólo hay síntomas una vez que ha progresado. En el Reino Unido, se estima que unas 600.000 personas padecen esta enfermedad, mientras que a nivel mundial se calcula que hay 44 millones de afectados. Los expertos estiman que la cifra de afectados puede llegar a 135 millones en el año 2050. El director de investigación de la organización benéfica Alzheimer Research UK, Eric Karran, que contribuyó a financiar este estudio, dijo hoy que esta prueba de sangre significa que estamos "bastante más cerca" de prevenir el mal.
------------

No comment yet.
Scooped by Refernan Ref
Scoop.it!

La nueva Esperanza de vida

La nueva Esperanza de vida | Novedades Cientificas y Médicas | Scoop.it

Haga clic aquí para editar el contenido

Refernan Refs insight:

COMO SE MOVERÁ LA ESPERANZA DE VIDA
--------------
Hay muchos supercentenarios que llegaron a la edad de 115 años sin ninguna ayuda de dietas ni edición de genes, es decir que ellos lograron llegar a esa edad sin sucumbir al cáncer, a las enfermedades cardíacas o al Alzheimer de forma natural. Esto muestra claramente, que hoy, todos podemos llegar a esos promedios de vida, con sólo mantener ciertos cuidados esenciales para protegernos de esas enfermedades. (https://es.wikipedia.org/wiki/Supercentenario)
--------------
Esto ya esta significando un promedio de 32 años más de vida al de una persona común de hoy, la cual alcanza los 83 años promedio, en los países más aptos. Probablemente lograremos también en poco tiempo descubrir alguna manera, ya sea mediante modificaciones genéticas o con la ayuda de organos artificiales, anexar algunas décadas más a esa nueva esperanza de vida. Por otro lado, nuestra idea de la vejez cambiará completamente cuando logremos saber como recomponer la piel y los músculos en los mayores. Con esos dos logros, las diferencias de edad, a simple vista desaparecerán, pues ya no habrá más arrugas ni cuerpos débiles que lo denoten. 
--------------- 
Para aquellos que no les interesa el vivir más tiempo, no deben preocuparse porque siempre podrán continuar falleciendo al ritmo que lo están haciendo hoy, que rondan un promedio de 80 años, cuando tienen buena suerte. 
---------------

No comment yet.
Scooped by Refernan Ref
Scoop.it!

Terapia Génica antienvejecimiento

Terapia Génica antienvejecimiento | Novedades Cientificas y Médicas | Scoop.it
Refernan Refs insight:

USANDO TERAPIA GÉNICA CONTRA EL ENVEJECIMIENTO
-------------------------------------------------------------------------------
En mamíferos, reducir la miostatina o aumentar la folistatina (que inhibe la producción de miostatina) se puede hace de varias formas, entre ellas con la terapia génica para la interferencia de ARN. Esto lleva a un aumento del crecimiento muscular, menor cantidad de grasa corporal y en ratones, al menos, una posible pero modesta extensión de la vida. La forma más directa es apagar el gen de la miostatina y es el camino elegido por investigadores chinos en trabajos con perros, usando CRISPR-Cas9, que es una forma de edición genética que es particularmente barata y precisa.
----------
Hay por lo menos una raza de perro en el que se ha producido una mutación natural del gene de la miostatina, e igual pasó con vacas, ratones (se llamaron ratones schwarzenegger), cerdos e incluso humanos, actualmente vivos y musculosos, como sus compañeros animales. La idea detrás es que la producción muscular mejorada es una terapia viable para para evitar problemas musculares conocidos y la sarcopenia, que es la pérdida progresiva de masa muscular y fuerza que se produce con el envejecimiento. Liz Parrish uso la folistatina o FS344 para actuar sobre la miostatina, lo que aumenta la masa y la fuerza muscular. Esto ha sido probado en pacientes con distrofía muscular.
----------
Es interesante contar que la empresa Bioviva, cuyo CEO es una mujer de 45 años, Liz Parrish, quién el 15 de septiembre, públicamente reconoció haber realizado una terapia génica de follistatina sobre ella misma, junto con otra alteración para evitar el acortamiento de telómeros: actuando sobre el gen mTERT, el cual en ratones de 1 año les alargó la vida un 24 % y en ratones de 2 años fue del 13 %. Lo hizo para adelantar los ensayos clínicos con humanos y los tratamientos dirigidos a frenar o revertir los efectos del envejecimiento. Como actuar sobre los genes esta prohibido en EE.UU. por la FDA, ella viajó a Colombia para hacerlo.
----------

No comment yet.
Scooped by Refernan Ref
Scoop.it!

CAMBIOS A REALIZAR EN MEDICINA...

¿Qué cosas podrían cambiar ahora mismo nuestras vidas?...pues tenemos varios cambios que ya podriamos haber hecho en la salud en EE.UU. y que aún no se implementan por temas burocraticos: en conjunto significaría bajar los costos medicos del ciudadano a un 20 % del costo presente, con mejor servicio y probablemente, aumentando nuestra esperanza de vida.
Refernan Refs insight:

Cambios a realizar en Medicina que salvarían muchas vidas. La tecnología ya esta disponible, pero la inacción o ineptitud o alguna otra razón impide que se lleven a cabo esos cambios, rapidamente...

No comment yet.
Scooped by Refernan Ref
Scoop.it!

Y llegó nomas: test sanguíneo para detectar el cáncer

Y llegó nomas: test sanguíneo para detectar el cáncer | Novedades Cientificas y Médicas | Scoop.it
Por unos 600 euros podría desencadenar una avalancha de sobrediagnósticos y sobretratamientos para tumores no peligrosos y falsos positivos
Refernan Refs insight:

EL FUTURO YA LLEGÓ, COMO DIJIMOS HACE MUY POCO

TEST SANGUÍNEO A DOMICILIO PARA DIAGNOSTICAR CANCER
EL DIAGNOSTICO PRECOZ Y NO LOS FARMACOS LE GANARÁN AL CÁNCER
----------------------------------------------
¿Detección anticipada del cáncer por poco más de 600 euros? Es el eslogan comercial de Pathway Genomics, una empresa diagnóstica de San Diego (EE.UU.) que la semana pasada empezó a comercializar un análisis de sangre que afirma que puede detectar mutaciones de ADN en las células cancerígenas presentes en el cuerpo humano. La prueba suena genial. ¿Quién no querría saber si tiene un cáncer escondido en algún rincón de su cuerpo? Pero no es tan sencillo. The Verge contiene una explicación detallada de la prueba y sus graves problemas.
-------------
"Si se demostrara eficaz, la prueba tendría una enorme importancia para la medicina porque podría emplearse para detectar el cáncer antes de que el paciente muestre síntomas. Pero Jim Plante, el CEO de Pathway Gemonics, le dijo a The Verge que la prueba de su empresa se había validado con el análisis de "cientos de muestras". Esto no impresiona demasiado, pues muchos opinan que para determinar si la prueba realmente ayuda requeriría miles de muestras, muchos años y millones de dólares. La prueba de Pathway Genomics, llamada CANCERINTERCEPT (CancerIntercept) está dirigida directamente a los consumidores, haciendo que consulten online con un médico de "telemedicina" para encargar la prueba. Yo rellené el formulario online de Pathway Genomics, y un comercial me llamó minutos después para explicarme que la empresa enviaría un "flebotomista móvil" (una flebotomía es una prueba para extraer sangre de la vena) a mi casa para extraerme la muestra de sangre.
-----------
La empresa ofrece un plan de suscripción, para que se realice la prueba con mi sangre cuatro veces al año. Por tan sólo 1.196 dólares (unos 1.047 euros) cargados en mi tarjeta de crédito. La empresa está dirigiendo sus esfuerzos comerciales a las personas que tienen motivos para creer que es probable que padezcan de cáncer. Esto incluye a personas con riesgos hereditarios de cáncer y los fumadores longevos, o las personas que han estado expuestas a la radiación. No es la primera vez que Pathway Genomics (empresa privada) pone a prueba los límites de las pruebas diagnósticas. Según Reuters: "La empresa ya se ha metido con anterioridad en problemas con un tema similar. En 2010, Walgreens retiró los kits de pruebas genéticas de Pathway Genomics de sus farmacias después de que los reguladores estadounidenses advirtiesen de que los pacientes podrían emprender acciones sin haber entendido los resultados".
-----------
Estas "biopsias líquidas" como se han denominado estos análisis de sangre, realmente tienen el potencial de detectar el cáncer de forma temprana y de posiblemente revolucionar el tratamiento del cáncer al permitir a los cirujanos extraer tumores antes de que puedan causar problemas. Las pruebas son capaces de detectar el cáncer porque las células cancerígenas moribundas liberan fragmentos de ADN en la sangre. Los primeros informes científicos que demostraron este fenómeno fueron dos artículos publicados en Nature Medicine en 1996, sólo que ahora se han vuelto más potentes y barata la tecnología de la secuenciación genética para ofrecer la oportunidad de una prueba de cribado rutinaria lo suficientemente asequible para la gente. El desarrollo fundamental científico de la tecnología de las biopsias líquidas se hizo en la Universidad de Johns Hopkins (EEUU). El año pasado, retratamos los esfuerzos del famoso biólogo de cáncer Bert Vogelstein, que nos contó que estaba convencido de que la detección temprana, no los fármacos, representa la mejor opción para vencer al cáncer.
------------
"Para Volgelstein, los análisis de sangre señalan que pueden detectar más de la mitad de los cánceres de forma temprana y curarlos mediante cirugía. El único problema serían los falsos positivos, que podrían asustar a la gente, haciéndola creer que padecen de cáncer cuando no es así. Otra posibilidad es que se detecten un cáncer que nunca nos mataría. Los altos costos medicos son altos. Como ya señalamos el año pasado: tomemos como ejemplo la prueba del PSA (prueba para el cáncer de próstata) donde hay falsos positivos, e igual se sugiere con la mamografía que provoca el sobre-diagnóstico y el sobre-tratamiento. Alrededor del 25% de los cánceres de mama detectados y tratados no habrían causado ningún síntoma.
------------

No comment yet.
Scooped by Refernan Ref
Scoop.it!

La hipertensión daña el cerebro también

La hipertensión daña el cerebro también | Novedades Cientificas y Médicas | Scoop.it
Refernan Refs insight:

EFECTOS DEL DAÑO POR LA HIPERTENSIÓN EN EL CEREBRO: 
MRI también llamado tractografía
------------------------------------------------
Una nueva técnica de imagen (MRI: tractografía) ha encontrado que algunas personas con presión arterial alta también tienen daños en vías nerviosas que conectan las diferentes partes del cerebro, según un estudio presentado en la Conferencia de la presión arterial alta de la American Heart Association 2015. El área de daño cerebral detectado está vinculada a las dificultades en ciertas habilidades cognitivas, la toma de decisiones y la capacidad de regular las emociones. El endurecimiento de los vasos sanguíneos debido a la reticulación en la matriz extracelular y otros factores como la calcificación son conocidos por causar hipertensión y la presión arterial elevada de hipertensión causa daño progresivo al tejido cerebral. El grado en que se produce este daño -que podría ser causante del deterioro cognitivo con el envejecimiento- es algo que esta cada vez más claro y las nuevas tecnologías de escaneo pueden mostrar.
-------------
"Ya tenemos maneras claras de ver que la alta presión arterial puede dañar los riñones, los ojos y el corazón y queríamos ver como evaluar el daño cerebral que podrían predecir el desarrollo de la demencia asociada con enfermedades vasculares, dijo Daniela Carnevale , Ph.D., autor y profesor asistente principal del estudio en la Universidad Sapienza de Roma, con sede en Neuromed Instituto. Carnevale propone una mirada a la materia blanca del cerebro podría decir si la presión arterial alta estaba teniendo un efecto aún más temprano que lo que se conoce.
------------
Los investigadores utilizaron imágenes de tensor de difusión (DTI), una mejora de la imagen de resonancia magnética (IRM), para evaluar y comparar Estructura y conexiones entre regiones del cerebro: 15 participantes tomaban medicamentos para la hipertensión y 15 participantes tenían presión arterial normal. Los participantes también tuvieron una evaluación cognitiva. El DTI más avanzado reveló que los participantes con alta presión arterial tenían daños en:

- las fibras cerebrales que afectan a las funciones no verbales;
- las fibras nerviosas que afectan el funcionamiento ejecutivo y la regulación emocional; y
- las fibras del sistema límbico, involucradas en la atención.
Además, las pruebas de imagen y de laboratorio indican daños en el corazón y los riñones por la alta presión arterial. También realizaron peor resultados en la función cognitiva y la memoria. Y no diferencias en la evaluación de la función verbal o actividades diarias.
-----------

No comment yet.
Scooped by Refernan Ref
Scoop.it!

LA ALIMENTACION HUMANA

Aprenda más sobre alimentación humana y salud
Refernan Refs insight:

APRENDA SOBRE EL QUE, COMO Y PORQUE DE SU DIETA
----------------------------------------------------
El video le enseña a mirar la alimentación desde varias opticas, incluso el economico. Asi entenderá de ecología real (no la publicitada), porque somos adictos a la comida y lo más importante, como aprender a comer para no dañar su cuerpo con el tiempo. Luego de ver unas dos o tres veces el video, para asegurarse que realmente entiende lo expuesto, le recomiendo que anote los temas que le ocasionen dudas y vaya a google a informarse mas profundo si lo desea...es la única forma que tiene de verificar la información correcta de la información basura...asi que, no dude en hacerlo, si realmente le interesa aprender!.

-------------

No comment yet.